Stephen C. Meyer has published a (very long, but readable) book, Signature in the Cell: DNA and the Evidence for Intelligent Design,
outlining his argument in favor of intelligent design. This book
essentially argues that life is very complex, the origin of life is a
puzzle, and the information content in DNA cannot be explained by
natural means.
In his book Meyer takes a chapter to discuss historical
reasoning – and the clues to causes. The basic questions are simple … How do scientists reason and make inferences about the past? Are these inferences testable? If so, how?
Meyer
discusses the ideas of inference to best explanation (IBE) and how to
evaluate causes. This is groundwork for his argument that chance and
necessity, happenstance and law, the “twin pillars” of evolutionary
thinking, fail to explain the origin of the information content of the
cell. He finds what he concludes is strong evidence for an intelligent designer.
Before considering more of
Meyer’s ideas, we will take another brief digression – but a digression related to these ideas of historical reasoning. There are two, or at least two, facets to the intelligent design movement. In broad
brush strokes – one face is, or seems, intent on undermining the
theories of evolutionary biology pretty much lock, stock, and barrel.
Evidence for macro evolution and common descent is fought and argued
against – vehemently at times. The other face argues that there is
empirical evidence for design and that natural mechanisms of evolution
alone (chance and necessity) are not enough to explain the origin of
life and perhaps not enough to explain the appearance of some complex
structures or systems.
Here is a question worth considering.
Do these two facets – the attempt to undermine all of evolutionary biology and the attempt to find evidence, scientific evidence, for an intelligent designer – really belong together?
Are they different faces of the same thing – or should they be considered separately?
On the “history” of evolution and the evidence for the broad brush theory.
There was an interesting post on Science and the Sacred by Gordon J. Glover last week – Evolution, Design, and History. In this post he gives an example of the changes on a city block and the remnants left behind as an analogy for the kind of pervasive evidence found in biology for both evolution and common descent. His illustration is really designed to get to the ideas of historical reasoning in much of evolutionary biology. The lines of evidence are persuasive. Comparative anatomy and the vestigial structures found throughout the animal kingdom provide strong evidence for common descent – features that make absolutely no sense under the assumption of special creation are well explained by the evolutionary theory.
Another body of evidence for the general evolutionary theory in biology is found in the genomes – the information codes, the DNA – for different species, including humans. The range of evidence is vast and growing. Francis Collins in his book, The Language of God, outlines a small fraction of this evidence. Darrel Falk in Coming to Peace With Science, outlines more. I posted on some of this a while ago (At Peace With Science). The genetic evidence also shows that evolution is not simply mutation and natural selection … it is much more complex. There was an interesting article in the NY Times this week Borna Virus Discovered in Human Genome illustrating one aspect of the complexity.
There is a third line of evidence found in the fossil record – we discussed Tiktaalik roseae on this blog a while back. But there is a fascinating discovery reported in the January 7th issue of Nature that puts new information into play – placing the appearance of tetrapods, through the indirect evidence of footprints – some 18 million years earlier than previously thought. This changes some aspects of the, still poorly understood, evolution of land animals. I am sure there are more surprises to come as the investigation of the fossil record continues. New discoveries are constantly refining the understanding of the evolutionary tree.
These three lines of evidence, and perhaps there are others, make the general theory of evolution clearly the inference to best explanation. There is no real doubt left. While we do not yet understand the whole process, the general scenario is as close to proven as anything ever is or can be in history or biology. Arguments against the broad brush history of evolution fall into the same general category as arguments that Napoleon never existed (an example Meyer uses in his book when discussing IBE), that Jesus was married, or that the holocaust never happened.
But what about Intelligent Design?
Nothing I’ve said above about evolution and the evidence for evolution addresses the central questions of Intelligent Design. In Signature in the Cell Meyer does not make an argument against evolution. His argument is much more sophisticated, and worth a much closer look. He argues that the inference to best explanation leads to a designer. Natural mechanism alone cannot explain the information content and complexity of even the most rudimentary forms of life. This is where we will turn in the next posts … to Meyer’s argument for design and a designer.
And a final word. I think that the ID movement damages its credibility (destroys might be
a better word) by fighting a battle against the general evolutionary
theory. This battle may generate support in the trenches of the church,
but prevents any real hearing for the positive proposals of intelligent
design. The arguments against evolution are generally illogical and full of
more heat than light. The distortion and rhetoric may comfort the faithful, but convinces no one and drives many away. Darrel Falk had an excellent post dealing with
some of these issues on Monday: Footprints in the Sand. Read it – and comment there or here (keeping in mind that we converse as friends over coffee to understand and persuade – not to score points).
Responses? What do you think? Do anti-evolution and pro-design arguments really belong together?
If you wish to contact me, you may do so at rjs4mail[at]att.net
posted January 14, 2010 at 8:24 am
Seems to me that ID and macro-evolution diametrically oppose to each other. To support one view is to inherently argue against the other. Because ID is the more recent theory, it must not only argue against the predominant theory, but also make its own supporting case.
posted January 14, 2010 at 9:10 am
RJS — excellent post. Loren Haarsma of Calvin College often makes many of the same points in his discussions of ID. Owen Gingerich of Harvard often speaks of “ID” (capital-I, capital-D) and “id” (small-i, small-d), which I think in some ways can be a useful distinction.
Epistemic virtue requires us to acknowledge the overwhelming evidence for common descent. However, there is plenty of room to discuss whether common descent can be fully explained by secondary (“natural”) causes alone. Even those of us who balk at ID for various reasons, it seems to me, need to acknowledge that the beauty and intricacy of creation right down to its deepest levels (the remarkable properties of DNA, the equations of physics, and so on) are best explained in the framework of nature as “creation.”
Still — there are stronger and weaker versions of this sort of “consilience / coherence” argument. Very strong versions of it seem to me to reify “information” to a point that is infeasible. One person I know in the ID movement insists that “information” is a fundamental constituent of the universe along with “energy” and “matter.” It’s an interesting idea because it could be consistent particularly with some Eastern Christian theologies of the divine logos. But it always seems to me to end up producing an excessively rationalistic, often combative, form of natural theology that I don’t believe is Biblically or theologically tenable.
posted January 14, 2010 at 9:53 am
The Design Spectrum
RJS,
ID has never involved an attack on the entire theory of evolution. “The theory of intelligent design holds that certain features of the universe and of living things are best explained by an intelligent cause, not an undirected process such as natural selection.”
http://www.intelligentdesign.org/index.php
It holds that natural selection does not explain everything, not that it does not explain anything. All ID proponents affirm micro-evolution, and some affirm many aspects of macro-evolution.
You make an obvious extrapolation error:
“While we do not yet understand the whole process, the general scenario is as close to proven as anything ever is or can be in history or biology.”
The evidence you cite does not prove that the Cambrian animals or biological nano-machines came about by random mutation and natural selection. There is much evidence to suggest that they did not. So your claim that “the general scenario” is proven is vague at best. I think it is wrong and highly misleading.
Also, the evidence cited by Collins and Falk was selective. I was quite disappointed that Collins largely ignored many of the biggest problems with evolutionary theory. It was striking how quickly he dismissed the Cambrian problem (with no mention of the Ediacara explosion). I had the impression that he had not really explored it personally.
posted January 14, 2010 at 10:07 am
The Design Spectrum
RJS,
You said:
This is simply wrong. Why oh why do you persist in pushing this nonsense? Do you have any support for this? It is clearly and repeatedly rejected by all the leading advocates of ID, and yet its detractors keep pushing this.
From intelligentdesign.org:
http://www.intelligentdesign.org/faq.php
I am so tired of pointing out straw man arguments.
posted January 14, 2010 at 10:45 am
RJS links to a post by Darrel Falk about the Tiktaalik fossil and skepticism about its significance. My initial comments to that article are here:
http://thedesignspectrum.wordpress.com/2010/01/14/the-significance-of-tiktaalik/
posted January 14, 2010 at 10:49 am
The ID advocate groups have in the past spent too much time trying to prove evolution wrong in stead of doing research and trying to formulate a theory of ID that can make some predications to use and be tested as further research. The ID movement needs to distance them selves from is the Discovery Institute because of their ?Wedge Document? and years of support of the book ?Pandas and People? have left a lot of people with the impression ID is tightly tied to creation science. The term it self ?Intelligent Design? may not be able to survive because of the link as a religious concept that has been created it the wake of this and the Dover trial. The people supporting ID need to quit using terms such as neo-Darwinism and micro and macro evolution. In the scientific world of evolution these terms to not exist and seem to only be used in setting up straw man arguments or trying to show a link between the two.
posted January 14, 2010 at 11:04 am
Bob #6,
What was the primary source of the information contained in your comment?
posted January 14, 2010 at 11:17 am
pds (#4, 5) — but you would admit, wouldn’t you, that ID is not used in this very limited way in popular apologetics?
I’ll also quote from Dembski, “Intelligent Design: The Bridge Between Science & Theology” (IVP 1999), p. 110:
Thus, in Dembski’s view at least, ID does not encompass “teleological” evolution, which seems to put him at odds with the breadth of the statements you quote. And herein is one of the problems: the articulation of what exactly “ID” is and isn’t is highly inconsistent among even its high-level theorists, not to mention its popularizers.
posted January 14, 2010 at 11:20 am
RJS made a number of mistakes in his critique, as pointed out above. Here is another one:
“… features that make absolutely no sense under the assumption of special creation …”
You’re arguing here against the proposal of special creation, which is quite different from and not a necessary component of ID theory. Additionally, the phrase “absolutely no sense” is an exaggeration which indicates that you’re trying to demean a position and not evaluate it in an objective manner. I will suggest a more dispassionate and open-minded view to ID and to what Meyer actually says.
posted January 14, 2010 at 11:26 am
pds,
I knew that this post would not go over well with you – but I am not trying to pick on straw men. What I am trying to do is to separate the straw men from the important questions.
I think this is important because the “straw men” are easily destroyed and the important questions are not so easily answered.
So – the intentional distortion of facts and use of ridicule and occasional inflammatory rhetoric to push an anti-evolution agenda is damaging.
With respect to your quote in #4:
Terms like … unpredictable, purposeless, no discernible direction, no goal … I think these terms are inconsistent with Intelligent Design capital I capital D and intelligent design (small i small d). I also think that they are inconsistent with orthodox christian faith.
But I don’t actually think that natural selection acting on genetic change (and random mutation is not the only source of genetic change) is necessarily unpredictable or purposeless with no discernible direction. “Goal” is a somewhat more loaded term – as a Christian I think that there is a goal, and goal is one place where the ID discussion may be fruitful.
My distinction above really has to do with this divide. The anti-evolution group argues that the historical progression with common descent is in error and that the hypothesis of natural selection operating on genetic change not only insufficient, but completely wrong.
From my point of view it seems as though you want to fuse both the “straw men” and the more substantive arguments. Why is this not the case? (I.e. how am I misunderstanding you?)
posted January 14, 2010 at 11:30 am
CBD,
I never claimed that Meyer makes what I’ve called an anti-evolution argument. I don’t think that he does make such an argument.
We will get to his pro-ID arguments in future posts.
And “absolutely no sense” with respect to anti-evolution is not an exaggeration – the anti-evolution argument makes as much sense as the attempt to argue that the holocaust did not occur (which is absolutely none).
posted January 14, 2010 at 11:31 am
re bob johnson and testability and predictions
It is a myth, though quite a popular one, that ID makes no predictions. ID advocates do make predictions, and Meyer includes a number in his book. Predictions / hypotheses that can be tested.
Moreover, Darwinian evolution fares quite poorly in the prediction department. It predicted useless vestigial organs, until it turned out that organs such as the appendix do have a function. It predicted junk DNA until it turned out that the junk is not so but has quite important functions. Then there are the things that Darwinism failed to predict, such as the Cambrian explosion, a matter for which Darwinism still lacks an adequate explanation.
Furthermore, there are many things that Darwininism cannot explain, such as altruism (unless one enjoys just-so stories).
One must also be cognizant of the fact that, as demonstrated by discussion about Poppers ideas, testing is not the sine qua non of science. There are several ways of doing science and evaluating scientific theories. Not all the ways are mutually exclusive or primarily dependent on testing (sorta what rjs was getting at by ABE).
Really, if we’re going to continue to accept a 19th century idea as still valid in the 21st, we should start teaching the ether theory and phrenology. We brings me to the disappointing fact of rjs’s overweening confidence and arrogance about the supposed factuality of the current theory (singular) of evolution. There are numerous theories, often conflicting, about evolution in general and about specific aspects of evolution. Quite unlike the situation we find with respect to the mechanics of the expansion of gas, the measurement of gravity, teh speed of light and the like that one experiences in the “harder” sciences.
Please note, however, that I don’t dispute that God can create however he wants to and can design and use whatever processes he desires. Nor am I arguing that there is no change overtime. I do believe, however, that random mutation is not a sufficient driver to deliver what we observe around us, and there is no current proof that it can.
regards,
#John
posted January 14, 2010 at 11:36 am
“And herein is one of the problems: the articulation of what exactly “ID” is and isn’t is highly inconsistent among even its high-level theorists, not to mention its popularizers.”
Same goes for evolution, so that puts them both in the same boat.
I too am good at making blanket statements: “And “absolutely no sense” with respect to evolution is not an exaggeration – the evolution argument makes as much sense as the attempt to argue that the holocaust did not occur (which is absolutely none).”
regards,
#John
posted January 14, 2010 at 11:42 am
I have read the Wedge Document, the transcripts form the Dover Trial, the Judges ruling from the trial, and have followed the Discovery Institute?s web site from 2004 on. I don?t think any one will say what is in these documents helped the ID brand name. The Discovery Institute and the term ?Intelligent Design? have become lighting rods on the subject and get in the way of any research that any one would try to do. Statements made by Phillip Johnson in early 2006 makes me believe he had become disillusioned with the whole process. Do you know if he still supports the Discovery Institute?
posted January 14, 2010 at 11:52 am
The Design Spectrum
David #8,
“Popular apologetics” is pretty broad, so it is hard to comment. I haven’t seen ID per se used that way.
As to the Dembski quote, we have to define all those terms. Behe and I are “theistic evolutionists” depending on how you define it. If you define it like Howard Van Till does, we are not, and Dembski is right.
RJS #10,
The anti-evolution rhetoric may be related to ID, but it is distinct. I think using the phrase “intelligent design movement” to include all anti-evolution rhetoric is not helpful to the debate.
As to the last point, I think this shows that you and Collins really reject the current, mainstream scientific theory of evolution in some respects, just like the ID folks do. You and Collins are on the “design spectrum” just like Behe and Dembski. You are all at slightly different places.
I plan to elaborate on this on my blog one of these days . . .
posted January 14, 2010 at 11:58 am
By the way, judging by the content of the Biologos blog recently, the “Theistic Evolution Movement” is mainly about attacking intelligent design (and often misrepresenting it).
posted January 14, 2010 at 12:07 pm
Bob #14,
I think you are talking about the “Dover, PA School Board Intelligent Design Movement.” Did you know the Discovery Institute criticized the Dover school board policy? Judge Jones was clearly confused, and he is confusing a lot of other people, it seems.
posted January 14, 2010 at 1:28 pm
“Did you know the Discovery Institute criticized the Dover school board policy?”
Only after the fact.
Before the fact they were delighted and encouraged it. This is according to the school board’s own lawyer.
Here’s the DI misrepresentation referred to by PDS:
MARK RYLAND (Discovery Institute): Sure, I’d be happy to respond. Let me back up first and say: The Discovery Institute never set out to have a school board, schools, get into this issue. We’ve never encouraged people to do it, we’ve never promoted it. We have, unfortunately, gotten sucked into it, because we have a lot of expertise in the issue, that people are interested in.
Richard Thomason…attorney from the Thomas More Law Center that represented the Dover school board:
First of all, Stephen Meyer, who is he, he is you’re, is he the president?
MARK RYLAND : He is the Director of the Center for Science and Culture.
RICHARD THOMPSON (TMLC): Okay, and David DeWolf is a Fellow of the Discovery Institute.
MARK RYLAND (DI): Right.
RICHARD THOMPSON:
They wrote a book, titled “Intelligent Design in Public School Science Curricula.” The conclusion of that book was that, um:
“Moreover, as the previous discussion demonstrates, school boards have the authority to permit, ,B>and even encourage, teaching about design theory as an alternative to Darwinian evolution — and this includes the use of textbooks such as Of Pandas and People that present evidence for the theory of intelligent design.” …and I could go further. But, you had Discovery Institute people actually encouraging the teaching of intelligent design in public school systems. Now, whether they wanted the school boards to teach intelligent design or mention it, certainly when you start putting it in writing, that writing does have consequences.
In fact, several of the members, including Steve Meyer, agreed to be expert witnesses, also prepared expert witness reports, then all at once decided that they weren’t going to become expert witnesses, at a time after the closure of the time we could add new expert witnesses. So it did have a strategic impact on the way we could present the case, cause they backed out, when the court no longer allowed us to add new expert witnesses, which we could have done.
Now, Stephen Meyer, you know, wanted his attorney there, we said because he was an officer of the Discovery Institute, he certainly could have his attorney there. But the other experts wanted to have attorneys, that they were going to consult with, as objections were made, and not with us. And no other expert that was in the Dover case, and I’m talking about the plaintiffs, had any attorney representing them.
So that caused us some concern about exactly where was the heart of the Discovery Institute. Was it really something of a tactical decision, was it this strategy that they’ve been using, in I guess Ohio and other places, where they’ve pushed school boards to go in with intelligent design, and as soon as there’s a controversy, they back off with a compromise. And I think what was victimized by this strategy was the Dover school board, because we could not present the expert testimony we thought we could present.
posted January 14, 2010 at 1:45 pm
I wonder how many physists agree with this proposition?
“Forces, fields, atoms and quarks are all unobservable.”
Question to any supporter of ID. Do you think this statement is an accurate expression of physics in 2010?
posted January 14, 2010 at 1:50 pm
pds (#15) — I have no problem admitting that I’m somewhere on the “design spectrum.” I think I disagree with where you place Howard Van Til, at least before he slid into something like pantheism or whatever it is he now thinks, but that’s ok.
To me, Dembski’s and to some extent Behe’s views boil down to this: secondary causes theologically aren’t good enough; there must be intervening acts of primary causation. To which I say, “why?”
Re: “popular apologetics”: Reasons to Believe, Focus on the Family (the “Truth Project”), Lee Stroebel, J.P. Moreland, and even AiG in some weird and inconsistent ways — all use ID arguments to argue that “evolution” can’t have happened, by which they mean, or are reasonably understood by almost everyone in the pews to mean, that common descent cannot be true (well, except that AiG sometimes argues for really rapid evolution / common descent after the flood…). If you live in the evangelical subculture, I don’t see how you can miss this.
posted January 14, 2010 at 1:51 pm
RJS,
You bring up an extremely important distinction. One has the basic fact of evolution (common descent). And then there is the question of whether natural mechanisms were/are sufficient to account for that descent, or whether some non-natural intervention/design is required.
Scientifically, to deny common descent is becoming increasingly absurd as genetic evidence (and other evidence) comes in. Maybe it would have been scientifically defensible 50 or 100 years ago but it certainly is not now. But there is room for legitimate questions on the second question.
If the ID movement would simply come clean and accept common descent and focus on the second question, I would have a lot more respect for it. Some design advocates do that (Mike Behe and Mike Gene come to mind) and I commend them for it. And as pds points out, some “official” ID statements at least express compatibility with common descent. Of course other ID people (Wells, Dembski, the people who pushed changes in Kansas school curriculum) give the impression of opposition to evolution in general.
As dopderbeck alluded, MOST of the use of ID at the popular level is to oppose evolution in general, to give false comfort to Christians whose theology and/or Biblical interpretation and/or culture-war perspective does not like common descent. If that is truly a distortion of ID as pds has claimed in the comments (and I agree that the better elements of ID avoid this), then the ID people need to be much more clear that their work does not undermine common descent. It would help if they would rebuke those who say harmful distorted things like (to paraphrase a former pastor of mine) “Christianity isn’t falsified after all because people like Mike Behe and Phil Johnson are showing evolution isn’t true after all.”
But I suspect that if they “came clean” with regard to common descent (and the age of the earth), a lot of their supporters would be pretty unhappy.
posted January 14, 2010 at 1:56 pm
UC #18,
Maybe you are talking about the “Thomas More Center Intelligent Design Movement”?
Perhaps readers are interested in knowing the other side and some crucial distinctions?
Setting the Record Straight about Discovery Institute’s Role in the Dover School District Case
http://www.discovery.org/a/3003
posted January 14, 2010 at 1:57 pm
pds (#15) — I have no problem admitting that I’m somewhere on the “design spectrum.” I think I disagree with where you place Howard Van Til, at least before he slid into something like pantheism or whatever it is he now thinks, but that’s ok.
To me, Dembski’s and to some extent Behe’s views boil down to this: secondary causes theologically aren’t good enough; there must be intervening acts of primary causation. To which I say, “why?”
Re: “popular apologetics”: Reasons to Believe, Focus on the Family (the “Truth Project”), Lee Stroebel, J.P. Moreland, and even AiG in some weird and inconsistent ways — all use ID arguments to argue that “evolution” can’t have happened, by which they mean, or are reasonably understood by almost everyone in the pews to mean, that common descent cannot be true (well, except that AiG sometimes argues for really rapid evolution / common descent after the flood…). If you live in the evangelical subculture, I don’t see how you can miss this.
posted January 14, 2010 at 2:01 pm
Oops, sorry for the double post!
Let me note this too, to follow up on AHH (#21): I became really disillusioned with the IDM a few years ago when I saw how the “Uncommon Dissent” blog community handled their relationship to TE arguments. There is no room for a “spectrum” there, at least in my experience. You buy whole cloth into their particular version of “design,” or you’re the enemy. That’s a major sign of weakness, in my book.
posted January 14, 2010 at 2:01 pm
pds,
I am reluctant to use the phrase “intelligent design” because of the way it has been entangled with and tainted by the anti-evolution rhetorical garbage I complain about in the post. I would liken this to the way some object to the use of the term “evangelical” because it has become tainted by connections.
But I am evangelical – and I believe that the God exists and designed the universe, world, life – intelligently even. Taking the evidence available, it is clear that once we have life (and the origin of life is a big open question) that natural selection acting on genetic change is an important part of the history of species, and I would say (although most scientific colleagues would disagree) of the creative mechanism of God.
All Christians are at some point on the design spectrum, I’ve never denied this.
What I object to quite strongly is not those who see design – but those who use dubious techniques to tear down the clear data and consensus on evolutionary history. This hurts – it hurts the credibility of all Christians and it damages the faith of many young Christians as they continue education in the sciences.
posted January 14, 2010 at 2:16 pm
David #20,
I have spent most of my reading time on Behe, P. Johnson, Collins, Dawkins (mostly from the library!) Falk, Meyer, and because of my deep interest in fossils, Gould, Eldredge, Stanley and others. That is, the science, not the pop applications of ID.
Moreland is the only one on your list that I have read some.
Collins’ blanket rejection of ID in biology in his book seems to me to be as foolish (and harmful) as any blanket rejection of evolution by the folks you allude to. Can we agree on that?
posted January 14, 2010 at 2:31 pm
David #24,
Ok, fair enough. Uncommon Descent can be abrasive. But it is only part of the IDM, and it is distinct from the science and logic involved. Go hang out at http://www.TelicThoughts.com or Thinking Christian.
By the way, Tom Gilson has an interesting interview with Stephen Meyer up here:
http://www.thinkingchristian.net/2010/01/stephen-c-meyer-interviewpodcast/
Everyone is discussing Signature in the Cell.
posted January 14, 2010 at 2:36 pm
I think that one of the most important jobs of a review is to undertake the review in a sympathetic way, that is, to take the highest, best and strongest meanings from the text, not the most cynical and worst. To state, unequivocally, that ID “attempt to undermine all of evolutionary biology” is by far overstating the case, and is misleading to boot.
regards,
#John
posted January 14, 2010 at 2:46 pm
pds,
Your statement in #26 about what you have and have not read gave me an “aha” moment.
You often accuse RJS, me, and others of attacking a “straw man” when we decry the use of ID as an anti-evolution (anti-common-descent) club in the culture wars. Now you say you have not read Lee Strobel’s “The Case for the Creator” or encountered FotF’s “Truth Project” (both of which lean on the Discovery Institute for their content and imply that evolution in general is incompatible with Christian faith).
It is those popular-level uses of ID that we are typically talking about, and I daresay those are more widespread and influential in the church than the scientific books you have read. So this is not a “straw man”, it really exists and is very influential, it just isn’t the part of the ID movement you have been most exposed to.
I hope this insight will make our future conversation more constructive.
posted January 14, 2010 at 2:48 pm
John#1453 (#28)
This is not a review of Meyer’s book – this is more of a book club discussion … and a many part discussion. We are only on the third post.
Not only this – but I stated in the post, and in comments that Meyer’s book does not make an argument against evolution, it makes an argument for design.
What do you think – are anti-evolution and pro-design arguments the same or should they be separated?
posted January 14, 2010 at 3:21 pm
The Design Spectrum
AHH #29,
Let’s discuss specific quotes from the pop IDM. Here is one from your earlier comment:
“Christianity isn’t falsified after all because people like Mike Behe and Phil Johnson are showing evolution isn’t true after all.”
I don’t see the big problem with that. “Evolution” in terms of the “grand theory of everything,” is not true. You and I agree on that. “Evolution” in terms of “random mutation and natural selection explains everything” is not clearly shown by all the evidence. I could point to hundreds of statements about “evolution” by famous scientists that are not “true.”
The problem is not the IDM. The problem is that people use the word “evolution” to mean different things, and confusion ensues.
Look who is trying to add clarity to the situation (!):
http://www.arn.org/docs/meyer/sm_meaningsofevolution.pdf
posted January 14, 2010 at 3:22 pm
AHH #29
pds has raised the strawman argument several times. I think the main reason for this is a failure to define exactly what he means by ID. His strawman claims come off as a “no true Scotsman” type of argument where whenever someone makes a statement about ID he can just say that’s not really ID. Real ID doesn’t do or say that.
For me the bottom line on ID is that it is not science. It does not adhere to methodological naturalism and depends entirely on an argument from ignorance. And since pds will likely say I’m engaging in a strawman argument, I will specifically note that when I accuse ID of this I’m referring to proponents of ID such as Behe and Dembski. One would assume that they are adequate representatives of “true ID”.
Behe is held up by many (most?) ID adherents as one of its foremost scientists. And yet (as far as I am aware) his greatest published scientific work is Darwin’s Black Box, a popular rather than scholarly work which is merely a modern rehashing of Paley’s teleological argument for a watchmaker. Behe has produced no experimental evidence for “irreducible complexity” which is basically an unfalsifiable proposition. Or rather the only way in which it is falsifiable is for it to point to a specific system (like the bacterial flagellum) and claim that it is irreducibly complex. That is merely a “god of the gaps” argument. Each time a specific system is shown not to be irreducibly complex, the adherent can just point to another. Rather than concluding “we don’t know yet” adherents to irreducible complexity appeal to a nebulous designer. This is essentially no different than people several hundred years ago attributing disease to demons.
And Dembski is on record as denying universal common descent. I’m not sure how one can deny this without repudiating evolution in general.
As for some comments above about the design spectrum, I have no problem with being on that spectrum either. Eugenie Scott called it the “creation/evolution continuum” in this article.
http://ncse.com/creationism/general/creationevolution-continuum
I fall somewhere in the theistic evolution part of the spectrum. But note that people in multiple categories on this spectrum could refer to themselves as adherents of “intelligent design”. Like RJS above, I could make that claim myself in that I do believe God is intelligent and that he designed the universe. In that regard, all Christians are adherents of “intelligent design”.
posted January 14, 2010 at 3:28 pm
pds #31
Aren’t you now engaging in a strawman argument? What scientists claim that evolution is a “grand theory of everything”? Or that “random mutation and natural selection explains everything”?
And if you can point to hundreds of statements about “evolution” by famous scientists that are not “true” then please throw out a handful and let’s discuss them.
posted January 14, 2010 at 3:38 pm
BradK
Evolution as grand theory of everything… Dawkins makes this claim. In The God Delusion he suggests that even the fact that the universe is tuned for life could be a result of “natural selection” (one of his more absurd claims – and he makes many rather absurd statements in the book). Biologists, he says, have had their consciousness raised by the revelation of evolution by natural selection.
But I am certainly not defending Dawkins.
pds,
What do you mean by random mutation and natural selection?
posted January 14, 2010 at 3:39 pm
AHH #29,
One more thought. Those sources you mention are not “intelligent design.” They are part of the “anti-evolution movement in the Evangelical church.” Big difference. It is easy to make that distinction. That was the source of my frustration.
Saying “James Dobson is wrong so intelligent design is wrong” makes as much sense as saying “Richard Dawkins is wrong so evolution is wrong.”
posted January 14, 2010 at 3:44 pm
RJS #34
Yeah, but Dawkins’ claim is not a scientific one either. Which is the point I’m trying to make about ID.
posted January 14, 2010 at 3:48 pm
pds #35,
If the ID movement would dissociate itself from the anti-evolution movement in the evangelical church – it would fare much better.
This is the major point of today’s post.
I think (although I am willing to be shown to be wrong) that too many are in fact part of the anti-evolution movement and don’t actually want to separate the two.
So it seems to me – Behe is not “anti-evolution” he is “pro-design”
Dembski doesn’t think evolution is right, but he makes many arguments as strictly pro-design. His pro-design arguments should be listened to and interacted with on that basis.
I am not sure where Meyer stands – but this book is “pro-design” and I will interact with his ideas on this basis.
posted January 14, 2010 at 3:51 pm
pds #35
“One more thought. Those sources you mention are not “intelligent design.” They are part of the “anti-evolution movement in the Evangelical church.”"
What is “intelligent design” then?
posted January 14, 2010 at 3:54 pm
BradK and RJS,
See this link.
http://www.arn.org/docs/meyer/sm_meaningsofevolution.pdf
RJS, RMNS is discussed in #4. Why do you ask?
posted January 14, 2010 at 4:01 pm
RJS #37,
I think that is an unfair demand. What would that mean? They don’t talk to others? They don’t fellowship? They ban YEC types from conferences?
Kind of like how Francis Collins won’t talk to ID proponents?
You have a duty not to engage in “guilt by association” tactics regardless of what Michael Behe and Stephen Meyer do. We all do.
posted January 14, 2010 at 4:02 pm
pds,
If you mean your comment number 4 on this post – no you didn’t define what you mean by random mutation there. I would like to know how you understand this concept.
posted January 14, 2010 at 4:18 pm
pds #39
“See this link.
http://www.arn.org/docs/meyer/sm_meaningsofevolution.pdf“
I am not sure what is your point in linking this article. Can you clarify?
posted January 14, 2010 at 4:24 pm
pds #40
Do you think it is unfair to expect scientists, even atheist ones, to publicly disavow some of the outrageous and unscientific claims made by Dawkins in the name of science? Rather than unfair, I think it is required by intellectual integrity.
posted January 14, 2010 at 4:26 pm
RJS,
No, #4 on the PDF I linked to.
Also,
“Natural selection is the process by which genetic mutations that enhance reproduction become, and remain, more common in successive generations of a population.”
posted January 14, 2010 at 4:53 pm
pds — on your comment about how Francis Collins handles ID in his “Language of God” book — generally, I agree with you. I admire Collins’ courage in writing that book, and I think his basic explanation of common descent is excellent. However, there are many parts of that particular book that aren’t very well thought out. My go-to here is Alister McGrath, whose various writings on epistemology and natural theology really track with me.
– on the link between popular evangelical apologetics and the IDM: I really don’t think you can sever that link, unfortunately. The big guns of ID often show up as conference speakers in these settings, sometimes along with the popularizers. This is the base from which they get much of their support. At least Collins et al. are crystal clear that they disagree with the likes of Dawkins.
posted January 14, 2010 at 4:59 pm
pds, I’m still not sure I understand what point you are trying to make here. Is this another variation of the creationist claim that “microevolution” is true but “macroevolution” is not? Considering that all biological organisms are based on DNA, which is basically a chemical code, like a book, shouldn’t the burden of proof actually be on those who would dispute that “random” (and I don’t like using that word) mutations in that code combined with selection pressure is NOT sufficient to explain “macroevolution”? What mechanisms or limits have been proposed that would prevent it?
Also, to which scientists is Meyer refering when he says “many scientists now question whether such mechanisms can produce the amount of change required to account for the completely novel organs or body plans that emerge in the fossil record”?
posted January 14, 2010 at 5:05 pm
dopderbeck #45
It’s been a while since I’ve read Collins’ book and I’ve loaned my copy out so I can’t provide specific examples, but I agree with your general assessment. In fact, my recollection of the book is that Collins sometimes engaged in a bit of argument from ignorance or philosophical hand waving at times.
posted January 14, 2010 at 5:08 pm
Correction to #46. It should read “shouldn’t the burden of proof actually be on those who would dispute that “random” (and I don’t like using that word) mutations in that code combined with selection pressure are sufficient to explain “macroevolution”? I double negated myself.
posted January 14, 2010 at 5:14 pm
pds #31,
It is either disingenuous or highly naive for you to claim that somebody in a church saying “evolution isn’t true” would be referring to a metaphysical “grand theory of everything” rather than the general fact of common descent. 99% of the people in the pews in an Evangelical church will interpret such a remark as something like “we are not related to monkeys”.
Absolutely the “grand theory of everything” must be separated from the science. Kudos to Tim Keller for doing just that (which theistic evolutionists have been doing for years). If only Johnson, Dembski, Strobel, and so forth would follow suit.
It sounds like we are agreed that people should distinguish between different meanings of “evolution.” Meyer’s attempt that you linked to for unpacking different meanings looks like it might be helpful, although #6 suffers from apparently equating natural processes with lack of metaphysical purpose (making the same mistake Dawkins does). Here is another attempt at delineation:
http://steamdoc.s5.com/sci-nature/Chapter5.pdf
Going back to the question RJS raised, it seems there are at least 3 issues at play:
1) Common descent
2) Scientific detection of design
3) Evolution as metaphysical “theory of everything”
Theistic evolutionists accept #1, reject #3, and are skeptical (but not necessarily rejecting) of #2. ID in principle is based on #2 and compatible with #1.
Would it not be better if ID proponents (both at the leadership and popular level) consistently made these important distinctions clear, to dispel the misconception that ID equates to anti-common-descent? Can we at least agree that it would be better if the church widely recognized the fact that ID arguments for design have no bearing on the question of common descent?
posted January 14, 2010 at 5:16 pm
BradK,
as you’ve discerned, it is difficult to get a definition of Intelligent Design.” Any usable definition is disavowed as “a straw man” definition.
ID proponents are very deliberate in refusing to define ID.
Here’s why. Compare the ID definition taken from the website of the Discovery Institute:
The theory of intelligent design holds that certain features of the universe and of living things are best explained by an intelligent cause, not an undirected process such as natural selection… Intelligent design has applied these scientific methods to detect design in irreducibly complex biological structures, the complex and specified information content in DNA, the life-sustaining physical architecture of the universe, and the geologically rapid origin of biological diversity in the fossil record during the Cambrian explosion approximately 530 million years ago.
The Discovery Institute is careful to distinguish ID from “Creationism” and does so in this language.
The theory of intelligent design is simply an effort to empirically detect whether the “apparent design” in nature acknowledged by virtually all biologists is genuine design (the product of an intelligent cause) or is simply the product of an undirected process such as natural selection acting on random variations. Creationism typically starts with a religious text and tries to see how the findings of science can be reconciled to it. Intelligent design starts with the empirical evidence of nature and seeks to ascertain what inferences can be drawn from that evidence. Unlike creationism, the scientific theory of intelligent design does not claim that modern biology can identify whether the intelligent cause detected through science is supernatural.
Dean Kenyon, a Discovery Institute Fellow, submitted an affidavit in the 1987 Edwards v Aguillard case, under penalty of perjury in which he defined “Creation Science” and distinguished it from “creationism. Here is how he distinguished “Creation Science” from “creationism” in 1987:
Creation-science means origin through abrupt appearance in complex form, and includes biological creation, biochemical creation (or chemical creation), and cosmic creation. Evolution-science is equivalent to evolution. Evolution is generally understood by scientists (although some would disagree) to include biological evolution (or organic evolution) from simple life to all plants and animals, biochemical evolution (or chemical evolution or prebiotic evolution of the first life), and cosmic evolution (including stellar evolution) (of the universe). Creation-science does not include as essential parts the concepts of catastrophism, a world-wide flood, a recent inception of the earth or life, from nothingness (ex nihilo), the concept of kinds, or any concepts from Genesis or other religious texts.
Dean Kenyon was one of the authors of the creationist/Intelligent Design textbook, “Of Pandas and People.”
Not coincidentally, ID surfaced after the Creation Sciece Defeat in Edwards.
http://pandasthumb.org/archives/2005/11/missing-link-cd.html
ID supporters must, accordingly be hazy in defining ID and most refuse to do so, because either the proffered definition inevitably overlaps with creationism, or is carefully parsed to to avoid the creationism overlap, the definition is content free.
DO not expect a precise definition of ID or any of its components any time soon.
posted January 14, 2010 at 5:34 pm
pds,
Back to my question about random mutation.
I think (probably no surprise to you) that #5 universal common descent is true – the evidence supports it and it should be taught in the schools. This undoubtedly means that Meyer and I part company.
With respect to #4 – there are certainly doubts that mechanisms of genetic variation proposed at various times could produce the rapid rate of change inferred from the fossil record and from the genomes of various organisms. Does this mean that the historical evidence for evolution is false or that there are additional mechanisms for genetic modification?
Popular conception is generally that we have some DNA chain: ATAGCAGACTCTATTTACTCT… a random mutation to one base changes the chain substituting one amino acid for another in the encoded protein and selected accumulation of such changes result in the diversity of life we see.
I doubt that this operation alone can account for the diversity of life. But I don’t think that this is the only operation that modifies the genome. Virus incorporation, gene duplication, and probably more modifications also occur. These can make more substantive changes more rapidly. Does this invalidate evolution? Or does it just broaden the available toolbox for “natural” genetic modification on which natural selection acts?
posted January 14, 2010 at 5:41 pm
David #45,
Good discussion requires that we define our terms. If you want to talk about the ID Movement consisting of James Dobson and the Dover School Board, I will smile, wish you well, and walk away. I have no interest in that. I think that conversation is beginning with a misleading definition.
If you want to talk about ID science and logic in its strongest form, I am interested.
This series is about Meyer and his book. I thought “great, we can focus on strong arguments.” So far it has been Noah’s Ark and the “Anti-Evolution Lock, Stock, and Barrel Movement.”
posted January 14, 2010 at 5:54 pm
pds,
I think that you will like the next post much better. But like Meyer, who puts much effort into the foundation of his argument, I wanted to lay this out on the appropriate foundation.
posted January 14, 2010 at 8:30 pm
pds (#52) — well, I didn’t say the ID “movement” consists of Dobson and Dover — what I said was you can’t just cut Dobson and Dover out of the “movement.” This is one of the reasons the “movement” is highly problematic as a “movement.”
But I think you know by now that I’m more than happy to cut through the muck to discuss ideas, so maybe it’s a problem to talk about the “movement” and who may or may not be included in that tent. As I said in #20, “[t]o me, Dembski’s and to some extent Behe’s views boil down to this: secondary causes theologically aren’t good enough; there must be intervening acts of primary causation. To which I say, “why?”"
If you strip away the “movement,” it seems to me there aren’t all that many “ideas” there, or at least not that many that anyone should much care about. The Christian Tradition has recognized the distinction between primary and secondary causation for millennia.
In fact, Augustine referred to secondary causation in response to the Stoic’s arguments for determinism, in a dialogue that could just as well be a debate about neuroscience and the will between John Polkinghorne and Richard Dawkins today. In the Book V of the City of God, Augustine summarizes the stoics? argument against divine foreknowledge as follows:
Augustine responded to this critique by referring in Aristotelian fashion to the order of causality:
For God to have sovereign foreknowledge over human affairs He need not “intervene” constantly in the exercise of human will, because these are different orders of causality. The same is true for Divine action and “natural” selection. So, at the level of ideas, I don’t understand what all the fuss is about.
posted January 14, 2010 at 9:02 pm
RJS: “ATAGCAGACTCTATTTACTCT”
God bless you! You might want to get that cold checked out. Sounds like Pneumonia could be setting in.
posted January 14, 2010 at 10:12 pm
“Comparitive anatomy and the vestigial structures found throughout the animal kingdom provide strong evidence for common descent.” To state the evidence for common descent of all living creatures, including Man, the similiarity of anotomical features, one has to make a philosophical, not a scientific, presupposition. That presupposition is that if special creation were true, there would be no similiarity between the anatomical structures, the building blocks of such structures and function of the structures of humans and animals. Since such similiarity exists, then this is evidence for evolution and the creation account in Genesis is therefore unreliable. There is no scientific basis for such a presupposition.
I have read Dr. Collin’s book and while he may know more about science than anyone commenting on this blog, his knowledge of Scripture as outlined in the book is almost nil. He emphatically states that there is nothing in the natural world that tells us anything about God’s nature. Apparently he has never read Romans 1 in which Paul gives the most famous arguement for knowing God’s character through nature. His attitude throughout the book is that where current evolutionary theories collide with Scripture, Scripture must give way.
posted January 14, 2010 at 10:38 pm
John,
No this is not the assumption …
That presupposition is that if special creation were true, there would be no similiarity between the anatomical structures,
In fact if all we were talking about in comparative anatomy and vestigial structures was similarity then you, and everyone else, would be justified in your skepticism. IN special creation similarity would certainly be a reasonable expectation. The kind of evidence found is much more subtle. Take a look a Glover’s post and try to understand his point – then at least we can talk about the real evidence.
posted January 14, 2010 at 10:54 pm
@ Dopederbeck,
Of course you are absolutely correct. At the level of ideas there would be no fuss.
But “Discovery Institute” ID, as distinguished from an uncontroversial idea that God is the creator, objects in principle to the idea that God has worked through evolution to create the diversity of life.
At a minimum, some DI Fellows hold that all of today’s species are descendants of recent flood survivors on the Ark (Paul Nelson and Nancey Pearcey are two DI Fellows who self-identify as YEC.)
Others deny common ancestry between homo sapiens and other primates and also deny common descent of all life forms. Those individuals hold to some extent or another that God separately created different kinds at various times in Earth’s history such as the Cambrian. These positions are indistinguishable from old earth creationism. Dembski, for example self-identifies as an Old Earth Creationist, who also believes in a literal Adam and Eve. Almost all other DI employees and Fellows fall into this category, including Stephen Meyers.
The sole exception is Behe. Behe concedes both common descent and common ancestry and argues that current evolutionary thought is almost entirely accurate, with the slight exceptions of two or three irreducibly complex systems such as bacterial flagella and malaria.
Even if Behe is correct, Behe’s “refinements” to evolution are as noticeable to biologists as relativistic effects are noticeable at normal speeds in normal gravitational fields–they have little or no effect on our everyday experiences and can generally be discounted.
Behe’s work has been seriously questioned and, as you know, he was not capable of distinguishing “ID” from creationism when he was cross-examined in Kitzmiller.
If the remaining DI creationist beliefs, either OEC, YEC or any other version are correct, then evolution as we understand it must be wrong.
It is not possible to simultaneously hold YEC or OEC beliefs and also accept the validity of evolution as we understand it.
That is why the Colsons, Dobsons, Strobels and other Christian apologists are working so hard to advocate ID. Evolution is utterly irreconcilable with their religious beliefs.
That’s why RJS’s question is so significant: “Do anti-evolution and pro-design arguments really belong together?”
If you are any form of creationist, the two arguments cannot be separated. There is no logical reason why these arguments cannot be separated, but if you are a creationist using ID as a form of apologetics, then the two arguments are essential to each other.
The problem is that the science is against the positive case for ID. Further research on the positive case is a waste of time and money. Rather than conduct any work on the positive case, most of apologetic effort is directed towards “attacking the weaknesses” of evolution. There is always room to attack weaknesses and hole sin any scientific theory because there are always areas for further research. In Short, there are “gaps” in our knowledge of any area of science. The “attackignthe weaknesses” focuses on these gaps.
Unfortunately, as the gaps close and the pre-Cambrian fossils are discovered and advances are made in molecular biology, the gaps become so small that ID attacks on weakness in evolution become deceptive.
To a large extent the ID program is probably self-deceptive. As Richard Feynman observed, “The first principle is that you must not fool yourself–and you are the easiest person to fool.”
For the reasons he described in his commencement speech, Intelligent Design is “Cargo Cult Science.”
http://www.lhup.edu/~DSIMANEK/cargocul.htm
posted January 14, 2010 at 11:13 pm
Common descent has not been proved at all, and is still an exercise in assuming the consequent. That is, if one organism containing DNA gave rise to all subsequent organisms, then all subsequent organisms should have DNA, etc. We see DNA in all organisms, therefore we assume that all organisms descended from some intial one. However, just because we see the consequent does not mean that the precendent is true. There could be other reasons why we share DNA (simpliciter) and why the DNA that all organisms possess exhibits much commonality.
Furthermore, use of various types of DNA to construct lines and trees of descent results in widely different lineages and trees, and these moreover are different from the trees built on the basis of morphology. Indeed, it is no surprise that in 2009 it was trumpeted that the so-called tree was dead. A tangled mass of in-grown, disconnected branches that make a knot so gordian that even Alexander couldn?t solve it.
Some of the comments on this thread appear to be ignorant (in the non-pejorative sense) of the extensive discussion in the middle of last century over the ?definition? of science. The result of that discussion was the conclusion that there does not exist a single unified agreed upon definition of science, nor could there be. Hence what science is depends greatly on the field being investigated. To assume that science can only be done via methodological naturalism is to make a pre-scientific philosophical commitment, and not that does not appear to be philosophical either justified or necessary. The confessional mandate of materialism / naturalism reveals a pre-scientific (i) atheism and (ii) stacking of the deck. That is, it assumes (in regard to ii) that any theory that is not committed to and based upon naturalism is a priori defined as ?not science?.
Re BradK (#32), evolutionists are pros at the no true scotsman game, and I don?t see how asserting that either way assists. It is the nature of the beast that there are various conflicting theories that vie in the marketplace of ideas regarding the development of life on earth. Science is not, or should not be, an exercise in signing and enforcing statements of right doctrine. Consequently variation in definition is to be both expected and encouraged. I would no more expect definitions of ID to identical among all theoreticians than I would expect the same to be true of theories of evolution. Even more so for ID since it is still a very young and changing theory / set of theories. Furthermore, the course of the existence and development of life over time would seem to be the more basic and accurate question, and one in which both no-ID-change-over-time (a.k.a. evolution) and ID-change-over-time evolution are on the field.
Re BradK (#46), since there is no extant example of random mutation of DNA resulting in ?macroevolution?, isn?t it more reasonable and probable to believe that it does not occur, and thus the burden is on those who propose such an unlikely and heretofore unobserved process for macroevolution? There is not, for any existant or extinct organism, a step-wise set of mutations that link one organism to one that is different on a ?macro? scale. Nor does it appear that there could be.
A significant problem for naturalistic evolution, and common descent, is that it is, per se, unfalsifiable and is categorically incapable of making useful predictions. Anything that we observe is assumed to be explainable by evolution (we just don?t know how, yet). There is no observable biological entity that could constitute something that falsifies evolution: it will be put down as something ?yet to be explained but we are confident it will? (a kind of evolution of the gaps). Anything odd that turns up will be put down to some historical contingency or other (and added to the repetoire of just so stories). If one finds different morphology or structures in different and unrelated species, that is accounted for by common descent. If one finds similar structures in unrelated species (eyes, etc.), then that too is ascribed to common descent. There is no possibility (as there is in other ?real? science) of distinguishing between outcomes. Every outcome is an outcome of evolution and common descent. Evolution and common descent predict everything, and therefore nothing. In fact, it is worse of than a theory that ascribes everything to an all-powerful, good being. At least for the latter there are moral constraints on what can be created and thus a distinction among outcomes (which is one reason why the problem of evil has so much traction).
Regards,
#John
posted January 14, 2010 at 11:36 pm
I have read Glover’s article and it has no bearing on the point I I was dealing with. My comment concerned the similiarity of the anatomical structures of Man and animals where Glover’s article dealt with human structures that appear to have no purpose. Richard Sternberg, not a Biblical creationist, takes issue with such reasoning Glover uses in his article. ( http://richardsternberg.org/pdf/sternintellbio08.pdf ) He recounts a talk given by Francis Collins in which Collins deals with the existence in humans of a dead gene: the “pseudogene.” Collins makes three points. A. We know this psuedogene has no function therefore it has no purpose. B. We also know that God would not make functionally purposeless objects. C. Therefore God had no role in the creation of the pseudogene. Its creation was a random event. Sternberg summarizes such reasoning this way: “I would not have done it that way, therefore God would not have done it that way.” He states that Collins is postulating on what God would or would not do based on human engineering standards. One could say the same about Glover’s article. He is making philosophical presuppositions about how God would create species. If there is no apparent purpose for a structure in humans, than its presence must evidence for evolution. Again, a philosophical presupposition, not a conclusion reached by scientific inquiry. I understand Glover’s point very well, but understanding is not the same thing as agreement.
posted January 14, 2010 at 11:51 pm
Having read Meyer’s book (and many others both for and against ID), I feel this discussion is ill-informed and misses multiple issues.
First, Meyer’s book is solidly a case for the creation of life, the stuff needed for evolution to act upon. It is not an argument for anything more nor is it an argument against evolution.
Second, I’ve spent my entire career building complex systems. The complexities of our systems pale in comparison to those in nature. What I find fascinating is how sensitive our systems our to tweaks and seemingly minor adjustments. What we’ve learned is systems *must* be holistically designed or they will not work. Complex systems do not grow organically, even when guided by an intelligence. Unless the end-game was in mind, small, incremental changes bog the system down, they do not extend it.
Third, the arguments from comparative biology support *either* evolution or design. Component reuse and reuse with modification are standard practices in design. As a result, all support from comparative biology is meaningless. It supports both, so it supports neither.
Fourth, the problems with unguided evolution are manifold once the notion of person-hood and consciousness enter in. The old school theories of mind riding on matter are failing; new schools look for consciousness as a basic component of the material universe. Even if this is granted, the notion of a persistent sense of self has not be satisfactorily answered by any theory in evolution.
Fifth, the swill of “survival” is much too thin to support any form of randomly driven evolution. We’ve learned from artificial evolution and evolutionary algorithms that the information needed by the end *must* be present in the system (in software it comes as rules guiding the program’s decisions) or they’ll fail. Modern work in this area concentrates on how to better design these key “fitness functions.” Survival of the fit contains insufficient information to guide anything.
Regards
posted January 15, 2010 at 1:55 am
#John1453 None of what you say is true.
1) “There could be other reasons why we share DNA”. Well what are they?
2) Piecing together the evidence will change the existing pattern of how the evolution of life forms occurred. That is how science is conducted. None of that disproves evolution and noone is throwing their hands in the air and abandoning the task.
3) The supernatural is not in any science theory no matter what definition of science you yourself accept. ID says it is a design theory but does not name the designer or define its methods. It attempts to hide its supernatural causality behind the word ‘intelligence’ but no one is fooled. If you can’t compare evolution’s causality and methods to a designer’s you can’t say ID is a better explaination. Just finding patterns is not good enough. It is the equivalent of seeing Jesus in your Taco. If you want to call something science it has to deal with reality. You can say nothing or everything about the unreal and supernatural but you can’t say anything scientific about them as science is a tool to explore reality.
Look the bottom line to all of these discussions is that you want science to validate your particular belief. Be honest, it is not like you are so objective that you would accept a science theory that proves Buddhism, it has to prove Christianity. But every time you ask this of science you are going to be dissapionted because it cannot validate faith in the supernatural. That does not make one right and the other wrong, it is just a case of using the wrong tool.
posted January 15, 2010 at 2:28 am
Here’s an equally effective and convincing rejoinder to B. Allen (#62):
Brett Allen None of what you say is true.
Now as for his points 1, 2, 3:
B. Allen has missed my point, which is that evolution has failed to prove (and cannot prove) that it is the only (by which I mean exclusive) explanation for common DNA. Logically, of course, there is no requirement for someone, who asserts that a theory is false, to provide an alternate theory. It’s nice if that person does, but it bears no relation to whether the theory in question is false or not.
As for potential explanations, here is one that fits within current scientific work on multiverses: a lifeform from one of the many universes of the multiverse started life in this universe and intervened occasionally in the past, but the contact between the two universes has now collapsed and no further contact is possible. That theory is entirely plausible if we presume that the multiverse is a reality, because there could be an (strong) infinite number of universes and an infinite number of times that life started, and, with an infinite number of multiverses it becomes likely that many such universes were in travellable contact with each other.
Piecing together evidence is a good thing, which is why I indicated that the real question is how life actual existed and developed over time and not an a priori commitment to either a particular theory or to methodological or philosophical naturalism. Indeed, such naturalism cuts off the useful pursuit of avenues of research. If the real universe is not solely material, then a materialist only approach to understanding the universe will fail to reveal (and even to investigate) the true nature of the universe.
As for finding patterns, the ID interest is not in any kind of pattern, but in particular kinds of patterns. Crystalline structures exhibit pattern, as does the action of waves on a beach. However, those types of patterns are not what are of interest to ID.
Finally, it is apparently a great surprise to B. Allen, but not every believer in nonmaterial existence is interested in these questions because she/he wants science to validate their particular beliefs. Given that atheism is a minority belief the world over, it seems rather more likely that atheism desires a materialist explanation for the universe and life in order to validate that particular belief. Gee, perhaps that’s why Dawkins wrote that evolution makes it possible to be an intellectually fulfilled atheist (though he is neither the only nor the first to say so). Moreover, belief in nonmaterial beings and God was capapble of validation before modern science existed and even now can be more convincingly demonstrated by means other than modern science, so
it’s hardly necessary to depend on or need science for validation.
regards,
#John
posted January 15, 2010 at 2:35 am
As I reflect upon rjs’ question (do the two investigations belong together) it seems more and more plausible to me that they do. If ID posits that it tells / reveals something that is true about life on earth, then at those points where it differs from evolutionary theories, those theories must be wrong. Hence, the ID project cannot only be about the positive aspect of its case, but also must be about proving that at least those parts of evolutionary theories with which it conflicts must be wrong. That then leaves us with the corollary that it is not strictly necessary for the ID project to prove that other aspects of evolution are wrong. However, and notwithstanding that corollary, if ID can prove that other significant parts of evolutionary theories are wrong, the stronger becomes its case in those areas where there is direct conflict.
regards,
#John
posted January 15, 2010 at 7:03 am
John (#60)
The problem I had with your comment is that no one really claims that similarity is proof of common descent. Similarity alone is consistent with either evolution or special creation.
The evidence for evolution is actually in remnants and pathways that make sense under the hypothesis of common descent and make little sense at all under the hypothesis of special creation.
The argument against the interpretation of vestigial structures and remnants indicating common descent is really that God could have created “imperfectly” – which is true. I think that the better explanation is that God used an elegant method in creation (evolution) that left these structures as evidence.
posted January 15, 2010 at 8:50 am
Re RJS (#65; the numbers for me often don’t seem to match up)
Yes, similarity alone is not the only datum that is believed to support materialist evolution, however, I was using it (the most obvious fact) as a shorthand for the whole enchilada (which I admit was not clear).
Nevertheless, it by no means follows that the evolutionary explanation is true, nor that it is reasoning to the best explanation for Christians. Christians should have no issue with change over time or with development of life / life forms. The question is not whether evolution or special creation is true, but what are the limits to change (if any), and also, what in fact did happen in history.
Moreover, Christians have more resources at hand to work with in coming up with explanations. For one thing, we have the corruption of the universe (which currently “groans” as God’s Word tells us) which could be an explanation for many features of biology. It is also not clear what role (if any) could be played by other spiritual beings such as angels (fallen or not).
These possibilities open up avenues and no more cut off or constrain research in materialist explanations than did the spiritual beliefs of many great scientists.
regards,
#John
posted January 15, 2010 at 9:00 am
Follower #61, to address your points:
1) Meyer’s book is a case for creationism – which is the belief that some powerful intelligent agent created the universe, life, or both. I’m not sure how “solid” it is, as it makes a single claim: “this looks designed, so it must be”. The same can be said of snowflakes, star systems, the hexagon on Saturn and snow rollers in Utah all look designed too. And life adds the cool capacity to retain good features while adding new – a capability that, when applied over billions of years, yields amazing results.
2) You said “Complex systems do not grow organically, even when guided by an intelligence. Unless the end-game was in mind, small, incremental changes bog the system down, they do not extend it.”
That is absolutely false. You don’t need an endgame to retain efficiency, you need a ruthlessly measured and enforced benchmark. Evolution does that – it’s the benchmark of “fitness” – the ability to survive and reproduce better than your peers. If the addition of a feature, however complex, makes an organism better able to survive and reproduce, then the feature will stay. There is no question that both E. coli and humans are able to survive well in their environments in spite of the fact that one is a bit more complex than the other.
And engineers DO use evolutionary algorithms to design stuff. These algorithms don’t have a desired end state. Instead they are guided by some sort of effectiveness or efficiency measure, and any “evolutionary step” that increases effectiveness or efficiency is retained.
So your assertion that only a holistic design can work is patently false, as is your claim that complexity bogs down the system. Are humans “bogged down” compared to bacteria?
3) Comparative biology clearly supports unguided processes – the sheer variety of features and relationships in nature is completely consistent with unguided, opportunistic evolution.
4) What does “persistent sense of self” even mean? Every component of our perception, memories and personality, even our sense of presence in our own bodies, can be altered by manipulating the physical brain or sensory inputs in some way. A person can suddenly acquire musical genius via electric shock, a person can be made to have an out-of-body experience – evidence supports that the human mind is entirely represented in the human brain and nervous system.
5) Your fifth point contradicts itself. You say that the rules guiding the system are what drive evolutionary algorithms, and then you reject “survival”. Survival, or more accurately, reproductive fitness, IS the guiding rule. Since we’ve seen new capabilities evolve in response to demands of natural selection, we know the process works.
posted January 15, 2010 at 9:13 am
John #66,
You say “Christians have more resources at hand to work with in coming up with explanations.”
That’s not what I’m seeing in this argument. I’m seeing those that follow evidence versus those that assume God then emphasize the evidence that supports God.
And, a LARGE number of Christians are completely constrained by what fits a literal interpretation of the Bible – some are even constrained by specific versions of the Bible.
When there is a observed, documented example of ANYTHING supernatural, then those that follow the evidence will accept that evidence and be very excited by it. But the 2000+ year failure of every single attempt to measure any supernatural influence on the natural world is in itself evidence. Based on this evidence of failure of the supernatural, it is a logical assumption for those who study nature to discount it just like patent clerks discount perpetual motion machines.
I’d LOVE to see evidence of a great deity who will ensure our race or our planet will continue on in some way. I’d LOVE to think there really is an afterlife where my mother can meet her mother again.
Alas, the evidence to day is 100% supportive of the claim that “natural phenomena have natural causes”.
posted January 15, 2010 at 9:22 am
RJS (#65) makes a key point that gets back to the original question in the post: what is the “inference to the best explanation” for viral DNA insertions, transcription errors, vestigial structures, and the like, particularly in light of other evidence such as the fossil record? The best explanation for all this is common descent over deep time.
Other aspects of what we observe — particularly the anthropic principle, the “information content” of DNA, apparently “irreducibly complex” structures, the evidence for convergent evolution, the phenomena of human consciousness and culture — seem to suggest that the “best explanation” for common descent over deep time is embedded in a broader context of purpose and teleology.
If “ID” is limited to the foregoing, it seems potentially useful to me. It is not basic “science”; it is a philosophical argument. It is not a “strong” natural theology; it is a more modest coherence with the prior metaphysical posture of Christian theism. And it does not render Christian theism defeasible if one or more or all of the teleological “markers” are basically explainable in terms of secondary causes.
posted January 15, 2010 at 9:45 am
The Design Spectrum
RJS and AHH and David O.,
RJS said,
I find this paragraph to be:
1. based on very faulty logic and extrapolation errors
2. hopelessly vague as to “the general scenario”
I think these kinds of statements and conclusions, and the bad logic in Collins’ book, will have the effect of dumbing down society and the Evangelical church in particular. These statements are at least as pernicious as the “anti-evolution movement” you decry.
I find this statement to be horribly simplistic and not supported by the evidence and sound reasoning. Yet RJS joins Richard Dawkins in putting me and Stephen Meyer and Michael Behe in the same category as holocaust deniers.
Given this kind of extreme rhetoric, you have no business demanding that ID proponents distance themselves from their “pop ID” supporters.
Until you realize that really really smart people who understand logic as well or better than you do think your reasoning is really really bad, we will not have good dialogue.
posted January 15, 2010 at 9:53 am
pds,
I don’t put Behe in that category at all – unless he has said something of which I am unaware.
I am not sure about Meyer – but his argument in Signature in the Cell is not in that category. We will deal with his strong argument and not deal with any possible peripheral argument not present in the book.
As for you – I have not been able to figure out where you are coming from, and this always makes it hard to dialogue.
Where I am coming from — I do think that IBE leads to the irrefutable conclusion of common descent through deep time. I do not think that it eliminates the possibility of design and we will consider these arguments (come back next Thursday for the next installment).
posted January 15, 2010 at 10:23 am
Oh, and Dawkins would put both me and Francis Collins in pretty much the same category he puts you, Meyer, and Behe.
I don’t pay much attention to Dawkins on issues of religion, as he does not really seem to want to enter into reasonable conversation.
posted January 15, 2010 at 10:57 am
RJS,
I am quite confident that Behe and Meyer would find that paragraph woefully simplistic and they would not agree with it. They would say that there is plenty of “doubt” as to the “general theory of evolution” as it is commonly described by many scientists. They have both made many arguments “against the broad brush history of evolution.” So yes, you are putting Behe and Meyer in that category.
Are all the scientists who signed the following statement on the same level as those who deny that the holocaust happened?
http://www.dissentfromdarwin.org/index.php
posted January 15, 2010 at 11:05 am
As a person who is still trying to figure out what the definition of ID is and what it says I would like to find out what ID says about the appearance of man on earth. Did the designer have one of the great apes give birth to the first several human and take care of them until adulthood or were they a lump of clay one minute and the next minute were they a fully developed human. I guess there could by a third option that the designer slowly changed the design of animals over time making design changes and branching out as he went to better adapted the animals to fit the different environments the designer created. What does the theory say and why have they come to that conclusion?
posted January 15, 2010 at 11:11 am
pds,
The statement at the head of that list is simply this:
We are skeptical of claims for the ability of random mutation and natural selection to account for the complexity of life. Careful examination of the evidence for Darwinian theory should be encouraged.
This is essentially only the bare basics of the design hypothesis – as in Meyer’s book for example. This statement does not require any kind of rejection of common descent through deep time. Nor does it require rejection or refutation of history.
I know many of the signers – some are young earth creationists for theological/biblical reasons; some are old earth progressive creationists; and some would hold to evolution as generally true but not enough. Those I know who are old-earth progressive creationists have not generally studied biology, but are in peripheral fields. They also don’t necessarily think that their position must be right.
One of the questions I would ask here – and a question that I have asked you – is what is random mutation … does anything really hinge on the absence of possible natural explanation? Refinement of one natural explanation does not necessarily lead to a conclusion of design.
posted January 15, 2010 at 11:15 am
Re Rickk (#67)
Rickk states, “Since we’ve seen new capabilities evolve in response to demands of natural selection, we know the process works.”
It is illogical and contrary to a naturalistic theory of evolution to assert that capabilities evolve in response to anything. Similarly, it is incorrect to speak of evolutionary “pressures”. Aside from the fact that “response” presumes either a mechanistic response (i.e. change in velocity in relation to applied acceleration) and or a personal identity (as does “demands”), it both misconstrues and misrepresents materialist evolutionary theory.
The increase in features is the result solely of undirected changes to DNA by way of mutation. Natural selection is the removal of same IF there are further genetic mutations in which the DNA for the feature is eliminated. Natural selection makes no demands whatsoever. What features and information remain in an organism are the result of the accidental vicissitudes in history. If a feature makes an organism less able to pass on its DNA, it will likely be lost by “natural selection”. If a feature makes an organism more able to pass on its DNA, it has an increased probability of being retained. If a feature is rather neutral in this regard, it may or may not be passed on.
Each of those three cases presume that further genetic mutations occur and that their distribution in the population of the organism is non-overlapping to a significant extent. That is, some organisms in the population must have a genetic mutation that removes the DNA information for the feature, and then those organisms must either reproduce more successfully than those with (because the environment has changed so that it no longer “favours” the feature) or because they have a further genetic mutation that enables them to reproduce more successfully than those that both have the old feature and do not have the new feature.
So-called environmental “pressures” change all the time, but they have no effect on the production of mutations (unless the pressure is something that actually causes mutation, like radiation). Animals go extinct all the time in the face of new or changed environmental “pressures”. The ones that survive are those that (among their many ongoing mutations) coincidental have mutations that enable them to reproduce more “successfully” in the changed environment.
So, unless the environment is mutagenic itself, it has no effect on the internal DNA mutations of the organism. What the environment does is continually kill off organisms and remove their genetic material from the population.
regards,
#John
posted January 15, 2010 at 11:18 am
Oh and as a clarification to #75 … “many of” does not mean I know a large percentage of the signers – I only know something more than 10. I know others who hold a similar range of positions, but have not signed this statement.
posted January 15, 2010 at 1:26 pm
@pds 73
The Dissent from Darwin list is meaningless. It is not a rejection of evolutionary theory. It is not a rejection of common descent. We KNOW there are more factors at work than just random mutation. There is, for example, symbiosis. Someone like Dr. Lynn Margulis might very well sign a statement like the “Dissent from Darwin” list. Yet this famous biologist and former wife of Carl Sagan would not in any way advocate creationism or intelligent design.
And then there is, of course, the weakness and sometime dishonesty of the list itself:
http://www.youtube.com/watch?v=Ty1Bo6GmPqM
And finally, if we’re looking at comparative lists, there is the list of scientists who DO support evolutionary theory (limited, for convenience and humor, to just scientists named “Steve”):
http://ncse.com/taking-action/project-steve
And there are the over 12,000 Christian CLERGY that accept that evolution is a foundational truth of our origins, and that to suggest otherwise is to “transmit ignorance to our children”.
http://www.butler.edu/clergyproject/Christian_Clergy/ChrClergyLtr.htm
So, if someone wants to get into a debate over evolution by wielding lists, evolution will prevail again, just as it has in any evidence-based test.
posted January 15, 2010 at 1:45 pm
pds: in #50 you said: “Behe and I are ‘theistic evolutionists’ depending on how you define it.”
Given that, I don’t understand your comment #70.
Behe would agree with me, RJS and others that common descent over deep time cannot reasonably be denied. As Behe says in “The Edge of Evolution” (p. 65), “the newest evidence from studies of DNA [convince] most scientists, including myself, that one leg of Darwin’s theory — common descent — is correct.” He then spends about 20 pages detailing the same genetic evidence used by Collins et al. to prove common descent. He even mentions the “compelling evidence for the shared ancestry of humans and other primates” based on hemoglobin genes and pseudogenes(p. 71).
If you accept these basic outlines but think the mechanisms of common descent and the possibility of primary divine intervention are in question, in my view that is a reasonable discussion. It’s the denial of the basic outline of common descent that still is a problem in some circles.
posted January 15, 2010 at 2:04 pm
RickK #78,
You misunderstand the reason I cited to that list. Take another look at my comment.
David O. #79,
The sweeping statement by RJS I quote in #70 includes more than “common descent.” It includes the mechanism.
By the way, I think limited common descent is plausible. I am skeptical of universal common descent. Has Behe ever stated whether universal common descent has been proven? He thinks that the “edge of evolution” is somewhere between genera and orders. What does that mean for “common descent” of the higher taxa?
posted January 15, 2010 at 2:38 pm
pds,
You are right that I was vague about “general evolutionary theory.” I was trying to separate the history from mechanism of how that history came about using terms like “general” and “broad brush strokes.” Clearly that was not how you read it. Let me try again a bit differently (with more words).
There is a deep time historically connected chain that links organisms. This connection is directional and causal. It demonstrates common descent by some mechanism over long spans of time all the way to vertebrates. It is clearly true among all vertebrates and among mammals.
It is also clear that at least some of the mechanism for this change is genetic modification, consistent with the hypothesis of random genetic modification.
The anti-history argument against the broad brush history of “evolution” (without reference to details of mechanism) fall into the same general category as arguments that Napoleon never existed (an example Meyer uses in his book when discussing IBE), that Jesus was married, or that the holocaust never happened.
Now we look at mechanism – and you have never yet defined the mechanism of evolution that you doubt. When you hear the word evolution what do you think it means?
posted January 15, 2010 at 3:19 pm
And a little more…
It is possible to doubt that the generally accepted mechanism of natural random genetic change is sufficient to bring about the diversity of life observed with out denying the history of evolutionary change.
It is also possible to doubt that any natural mechanism could bring about the diversity of life observed without denying the history of evolutionary change.
The problem that I have is with those who try to undermine evolution by denying the history of evolutionary change. Every argument I’ve heard to-date that takes this tack is woefully inadequate and deserves the ridicule it receives. Many don’t even try to make a logical argument, but resort to rhetorical tricks and misdirection.
My post here is really to try to separate these three things – so that we can actually consider Meyer’s argument that no natural mechanism could bring about the diversity of life seen.
posted January 15, 2010 at 4:42 pm
RJS,
You are absolutely correct that it is possible to doubt that current understanding of any natural mechanism is incomplete and not capable of serving as a complete explanation for the diversity of life. Scientists such as Lynn Margulis, Steven Gould and James Shapiro have all made suggestions along this line at various times. There is no question that evolutionary biology is a work in progress and our understanding is improving all the time.
None of these scientists, however, ever denied the history of evolutionary change. You’re correct in drawigna distinction between suggesting that current explanations re incomplete (as they surely are) and arguing that the history developed using the explanations we do have is incorrect.
You succuntly identified the problem. I was far more verbose above, in my effort to make this point. IF YOUR OBJECTIONS TO EVOLUTION ARE FOUNDED ON A PERCEIVED CONFLICT WITH SCRIPTURE, then you have no choice and you must reject the history of evolutionary change. That was the point of my discussion detailing the link between creationism and the Discovery Institute.
Therefore, we can expect that any challenges to evolution that deny the evolutionary history will be made because the history conflicts with the religious beliefs of a certain subset of (mostly) Christian adherents and the challenges will come from that subset of Christianity (e.g., Dobbs, Strobel, Colson, Dembski and all the others) and not from working biologists.
posted January 15, 2010 at 4:47 pm
PDS:
“Has Behe ever stated whether universal common descent has been proven? He thinks that the “edge of evolution” is somewhere between genera and orders. What does that mean for “common descent” of the higher taxa?”
Behe says he accepts commmon deecsnet and common ancestry in the opening pages of Darwin’s Black Box:
“Evolution is a controversial topic, so it is necessary to address a few basic questions at the beginning of the book. Many people think that questioning Darwinian evolution must be equivalent to espousing creationism. As commonly understood, creationism involves belief in an earth formed only about ten thousand years ago, an interpretation of the Bible that is still very popular. For the record, I have no reason to doubt that the universe is the billions of years old that physicists say it is. Further, I find the idea of common descent (that all organisms share a common ancestor) fairly convincing, and have no particular reason to doubt it.”
How he reconciles that with your second quesiton is anybody’s guess. It does appear he is inconsistent.
posted January 15, 2010 at 7:31 pm
And without a demonstrable workable mechanism the naturalistic argument for common descent is another batch of “just-so” stories, only not as entertaining as Kipling’s. It is evident that there is a series of different animals embedded in rocks of successive times. What is the explanation for that? I’m not the least convinced that materialist evolution provides the most adequate explanation. I’m not against exploring that possibility, nor is it impossible for God to have used such a process. But to claim that it is as true as gravity or the holocaust (skirting close to proving Godwin’s law) really amounts to so much hand and flag waving.
Plantinga makes the following useful comment: ?The theist knows that God created the heavens and the earth and all that they contain; she knows, therefore, that in one way or another God has created all the vast diversity of contemporary plant and animal life. But of course she isn?t thereby committed to any particular way in which God did this. He could have done it by broadly evolutionary means; but on the other hand he could have done it in some totally different way. For example, he could have done it by directly creating certain kinds of creatures?human beings, or bacteria, or for that matter sparrows and houseflies?as many Christians over the centuries have thought. Alternatively, he could have done it the way Augustine suggests: by implanting seeds, potentialities of various kinds in the world, so that the various kinds of creatures would later arise, although not by way of genealogical interrelatedness. Both of these suggestions are incompatible with the evolutionary story.”
“A Christian therefore has a certain freedom denied her naturalist counterpart: she can follow the evidence where it leads. If it seems to suggest that God did something special in creating human beings (in such a way that they are not genealogically related to the rest of creation) or reptiles or whatever, then there is nothing to prevent her from believing that God did just that. Perhaps the point here can be put like this: The epistemic probability of the whole grand evolutionary story is quite different for the theist and for the naturalist.?
regards,
#John
posted January 15, 2010 at 10:23 pm
#john1453 @85:
RJS did not say that “materialist evolution” was as strongly supported by evidence as gravity or the Holocaust. She made that statement about “the broad-brush history of evolution”, meaning the basic well-attested fact of common descent through genetic modification. That is different from the question of what produced that descent, and infinitely different from the question of the metaphysics (materialist or otherwise) behind the process.
One of the most counterproductive things in discussion of these issues is when metaphysics and science are conflated. None of us here who think God has created via evolutionary means is advocating “materialist evolution”. Please reserve that phrase for those who deserve it, such as Richard Dawkins. It is a huge mistake when Christians follow atheists like Dawkins in assuming that evolution must entail materialist metaphysics.
posted January 16, 2010 at 11:32 am
The Design Spectrum
RJS #81 and #82,
Thanks for the clarification. It is better, but I still have issues with it.
If you accept the fossil data at face value, you are not a history denier. If you believe that they do not suggest universal common descent, you are not a history denier. Taking the Cambrian fossils without special pleading does not create an inference of universal common descent, in my opinion.
“Common descent” without a mechanism does not make much sense to me. I don’t think you can separate “common descent” from “natural selection” so easily.
posted January 16, 2010 at 11:43 am
The Design Spectrum
John,
That is a great quote from Plantinga. Where is that from? Can you post the work and page number?
AHH,
Why do you presume John is talking about metaphysics? He could be referring to methodological materialism or naturalism.
I think Christian scientists sometimes give up the “freedom” that Plantinga describes because their methodological naturalism causes them to put too heavy a thumb on the scale in favor of naturalistic explanations. Sort of a Naturalism of the Gaps fallacy.
RJS and I discussed this a bit a while back.
posted January 16, 2010 at 12:02 pm
pds,
There is not just the fossil record. There is the fossil record, and the anatomical record, and the genomic record, and perhaps more. If you take any of these separately … one can construct logical alternatives (although it is becoming harder). Taken together, the general narrative is built up into a coherent whole. One hypothesis fits all the data …
#John 1435 (#85)
I don’t think that the epistemic probability of the whole grand evolutionary story is so different for the theist and for the naturalist on any level that counts in the practice of science. This concept is used to suggest that naturalist will accept absurdity because there is no alternative while the theist has alternatives. But the fact is that, in the long run, neither accepts absurdity – and we do not know or understand all yet.
But the quote in general is excellent – the theist knows that God created and how is not the issue. Thus as a scientist I can take the evidence as it stands and run with it. ANd this is where I, as a theist, part company with many who fight hard for ID … I will consider ideas put forth by those thinking about ID on their merits, but I have absolutely no stake in their conclusions being right or wrong. It just plain doesn’t matter how God created the world or life.
posted January 17, 2010 at 11:54 pm
#John1453
“evolution has failed to prove that it is the only explanation for common DNA”
Look an actual scientific theory has to fit all of the facts, be falsifable and hopefully predictive. It doesn’t beat it’s chest and attempt to denounce all other theories like ID proponents do. If you think evolution is defective you raise a scientific argument and present a new theory. You don’t expect an existing theory to address every other notion. Also a multi-verse is a cosmological theory it is nothing to do with biology unless you have some biological evidence. This theory has failed to prove itself let alone be used in biology. “Things may work differently in another universe” is speculation it is not science. “If the real universe is not solely material…”. Any scientific proof? You can’t put forward a ‘if’ with no proof and then use that to bash science and claim you know the ‘truth of the universe’ better. What could science say about non-material, magical or supernatural entities anyway. If they existed they would be real and thus could be studied. But if they are no reality about them, then looking for patterns in DNA or whatever does not make them real. ID says the patterns it sees piont to a supernatural ‘intelligence’. But because they have no idea what this intelligence is or its methods it is impossible to say that these patterns found piont to it. As for atheism, please! To even bring it up shows your interest is religion not science. Athiests don’t need reassurance as they deal with reality and reality is its own reassurance. The idea with all people who want to believe in ID is that if you can disprove evolution that somehow that will defeat atheism. People are not athiest because of evolution but due to the complete lack of any evidence outside of faith that a god exists. “belief in nonmaterial beings and God was capapble of validation before modern science existed and even now can be more convincingly demonstrated by means other than modern science” Really? The only real thing about religion is ‘faith’ which is real as any human behavior. But I could be wrong so what are these means and validation outside of faith that confirm non-existent entities exist.
posted January 18, 2010 at 9:24 pm
Actual Scientific theories must make predictions for them to be of any value. Is Fox ? Wolf lineage an example of micro- or macro- evolution? If macro-, then what is the irreducibly complex difference? In fact, at no point in the path backwards through the evolution and diversification of mammals does ID specifically point to even one signature event of the Intelligent Designer.
ID makes no predictions and takes no stance because it is a flawed:
William Dembski, February 17, 2003
?The question, then, that requires investigation is not simply what are the limits of evolutionary change, but what are the limits of evolutionary change when that change is limited to material mechanisms. This in turn requires examining the material factors within organisms and in their environments capable of effecting evolutionary change. The best evidence to date indicates that these factors are inadequate to drive full-scale MACROEVOLUTION. SOMETHING ELSE IS REQUIRED ? INTELLIGENCE.?
From the Discovery Institute website, 2009
?This fall Meyer came out with a full account of what science has learned in recent decades: Signature in the Cell shows that the cell is incredibly complex and the code that directs its functions wonderfully designed. HIS ARGUMENT UNDERCUTS MACROEVOLUTION, the theory that one kind of animal over time evolves into a very different kind. Meyer thus garners media scorn for raining on this year?s huge celebration of the birth of Charles Darwin 200 years ago and the publication of On the Origin of Species 150 years ago.?
From the Discovery Institute website, 1999
?Let?s teach students to decipher conflicting usages of the term evolution. No one denies the fact of limited, cyclical variation, represented by dog breeds, crop varieties, and insect resistance to pesticides?sometimes called ?microevolution.? WHAT IS PROBLEMATIC IS ?MACROEVOLUTION,? the conjecture that these minor variations are unlimited and directional, capable of producing dogs and corn and insects in the first place.?
posted January 19, 2010 at 6:49 am
http://thedesignspectrum.wordpress.com/
RJS #89,
I am considering all the evidence. The Cambrian fossils don’t fit the evolutionary paradigm without a lot of special pleading. The other areas you mention pose problems as well.
R Hampton #91,
You misunderstand ID. Have you read Meyer’s book?
posted January 19, 2010 at 2:38 pm
pds,
I understand ID without any difficulty. You, however, are either ill-informed or deliberately misleading. From the testimony of Stephen Meyer Ph.D. at the Kansas Board of Education’s “science hearing” in May, 2005:
I would make one more comment, and that is I think your Indicator 3d, which makes a clear distinction between micro and macroevolutionary changes is excellent and altogether needed, and I understand that it’s criticized in the media and with — I believe it was in the criticism — the critical report I read of this from Ken Miller, the distinction between micro and macroevolutionary is kind of a fiction created by anti-evolutionists.
I have — I published a peer review paper last fall with the proceedings of the Biological Society in Washington published out of the Smithsonian Institute, and in the opening section of that article I cited a number of papers in the evolutionary biology literature that make precisely the distinction that you’re making. This is not some kind of creationists fiction or construction, nor is it something that only critics of Darwinian evolution discuss. This is a well established distinction within the literature of evolutionary biology, and the problem is well noted that the (unintelligible) and effect of microevolutionary processes does not seem to be sufficient to explain the macroevolutionary changes and innovations that appear in the history of life. So processes of speciation are not sufficient to generate the new organism, body (unintelligible) and to correspond to the (unintelligible) level of changes and other level changes that appear in the history of life.
posted January 20, 2010 at 11:41 am
Are chimps and humans considered separate species by ID proponents? The research I’m reading seems to indicate gene duplication and divergence, and the weird chromosomal event, explain much of the difference between humans and chimps.
http://www.biomedcentral.com/1471-2148/8/195
In the human/chimp speciation difference, I’m not seeing a big gap that requires filling with intervention by an intelligent designer.
Meyer’s statement “microevolutionary processes does not seem to be sufficient to explain the macroevolutionary changes and innovations” appears to be false.
Unless of course we just consider humans and chimps members of the same species. Or, to use the terminology that Meyer REALLY wants to use, we could say humans and chimps are of the same “kind”.
For reference: Stephen Meyer’s public relations strategy to use “design theory” to “replace materialistic explanations with the theistic understanding that nature and human beings are created by God.”
http://www.antievolution.org/features/wedge.html
This PR strategy was meant to be secret within the Discovery Institute, but was leaked by a copy shop employee.
posted January 26, 2010 at 10:40 pm
The Discovery Inst. blog has posted a reply here:
http://www.evolutionnews.org/2010/01/getting_id_right_more_response.html